Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1183947
End position: 1183970
Length: 24

DNA sequence
>NC_008699, from 1183947 to 1183970 (24 bp); Nocardioides sp. JS614 CCGAGCGCGAGCCCGAACCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1181997-1184540	Sequence	Noca_1117 - ATPase domain-containing protein (Protein is coded in complementary strand; from 1184540 to 1181997)