Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1168528
End position: 1168551
Length: 24

DNA sequence
>NC_008699, from 1168528 to 1168551 (24 bp); Nocardioides sp. JS614 ACTCTCTCTCTCTCTCTCTCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1167904-1168581	Sequence	Noca_1105 - restriction modification system DNA specificity subunit