Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1125745
End position: 1125768
Length: 24

DNA sequence
>NC_008699, from 1125745 to 1125768 (24 bp); Nocardioides sp. JS614 CGTGGTCGGGGTCGAGGTCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1125528-1126547	Sequence	Noca_1066 glpX fructose 1,6-bisphosphatase II (Protein is coded in complementary strand; from 1126547 to 1125528)