Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1118803
End position: 1118826
Length: 24

DNA sequence
>NC_008699, from 1118803 to 1118826 (24 bp); Nocardioides sp. JS614 TCCGCGACCGCGTTCGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1117666-1119063	Sequence	Noca_1059 fumC fumarate hydratase (Protein is coded in complementary strand; from 1119063 to 1117666)