Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4739301
End position: 4739363
Length: 63

DNA sequence
>NC_008595, from 4739301 to 4739363 (63 bp); Mycobacterium avium 104 GTAGTCGTCGGGGGCTGGTAGGTCGTCGTCGGGGGCTGGTAGGTAGTCGTCGGCGGCTCGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4739091-4740761	Sequence	MAV_4606 - hypothetical protein (Protein is coded in complementary strand; from 4740761 to 4739091)