Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4175446
End position: 4175508
Length: 63

DNA sequence
>NC_008595, from 4175446 to 4175508 (63 bp); Mycobacterium avium 104 AGCCCGGTTTGGCGCCGCCCGACGCCGGTTTGGCGCCGCCCGACGCCGGTTTGGCGCCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4174536-4175921	Sequence	MAV_4056 - oxidoreductase, short chain dehydrogenase/reductase (Protein is coded in complementary strand; from 4175921 to 4174536)