Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4596715
End position: 4596774
Length: 60

DNA sequence
>NC_008595, from 4596715 to 4596774 (60 bp); Mycobacterium avium 104 TCTTCGCGGGTGCCTTCTTGGCGGGTGCCTTCTTGGCCGGGGCCTTCTTGGCCGGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4596651-4597193	Sequence	MAV_4466 rplV 50S ribosomal protein L22 (Protein is coded in complementary strand; from 4597193 to 4596651)