Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2242644
End position: 2242703
Length: 60

DNA sequence
>NC_008595, from 2242644 to 2242703 (60 bp); Mycobacterium avium 104 CCTGTTGGGTGGGCGGATGTCGGGTGGGCGGGTTTTGGGTGGGCGCCTGATCGGTGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2241608-2243248	Sequence	MAV_2235 - adenylate cyclase, putative (Protein is coded in complementary strand; from 2243248 to 2241608)