Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5013681
End position: 5013734
Length: 54

DNA sequence
>NC_008595, from 5013681 to 5013734 (54 bp); Mycobacterium avium 104 GCTCGACGTGGCTCGTCGGCTCGACATGGCCCGTCGGCTCGACATGGGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5012819-5013763	Sequence	MAV_4880 - hypothetical protein (Protein is coded in complementary strand; from 5013763 to 5012819)