Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4958987
End position: 4959040
Length: 54

DNA sequence
>NC_008595, from 4958987 to 4959040 (54 bp); Mycobacterium avium 104 CCCCGCCGAAGGGACCGTGGCCGCCGAACGGACCGTGCCCGCCGAAGGGACCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4958875-4960347	Sequence	MAV_4826 - hypothetical protein (Protein is coded in complementary strand; from 4960347 to 4958875)