Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4627165
End position: 4627218
Length: 54

DNA sequence
>NC_008595, from 4627165 to 4627218 (54 bp); Mycobacterium avium 104 GACGCCCGGCGACGCCCGCGAGCCCGGCGACGCCCGCGAGCCCGGCGACGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4626385-4627362	Sequence	MAV_4501 - endonuclease IV (Protein is coded in complementary strand; from 4627362 to 4626385)