Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4519737
End position: 4519790
Length: 54

DNA sequence
>NC_008595, from 4519737 to 4519790 (54 bp); Mycobacterium avium 104 CCGGTCGGCGCGGCCTCGCCGCTCGGAGCGGGCTCGCCGCTCGGTTCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4519560-4521026	Sequence	MAV_4382 - hypothetical protein (Protein is coded in complementary strand; from 4521026 to 4519560)