Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4460947
End position: 4460991
Length: 45

DNA sequence
>NC_008595, from 4460947 to 4460991 (45 bp); Mycobacterium avium 104 CGCGCCGCGCAGGTCCGCGCCACGCAGCACCGCCTTGCGCAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4460786-4461343	Sequence	MAV_4327 - hypothetical protein (Protein is coded in complementary strand; from 4461343 to 4460786)