Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3964368
End position: 3964412
Length: 45

DNA sequence
>NC_008595, from 3964368 to 3964412 (45 bp); Mycobacterium avium 104 GGGCCGGAGCCTTCTTGACCGCAGCCTTCTTCGCCGGGGCCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3964184-3964837	Sequence	MAV_3836 hup DNA-binding protein HU (Protein is coded in complementary strand; from 3964837 to 3964184)