Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3887789
End position: 3887833
Length: 45

DNA sequence
>NC_008595, from 3887789 to 3887833 (45 bp); Mycobacterium avium 104 TCAGGCTCGGCTGCTTCCGGCGCGGCGGCTTCCGGCTCGGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3887735-3888247	Sequence	MAV_3764 rpsP 30S ribosomal protein S16 (Protein is coded in complementary strand; from 3888247 to 3887735)