Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3767328
End position: 3767372
Length: 45

DNA sequence
>NC_008595, from 3767328 to 3767372 (45 bp); Mycobacterium avium 104 GTAGTCCCCGTCGGTGTAGTCCGCGTCGGTGTAGTCCTCGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3765604-3767931	Sequence	MAV_3639 - FtsK/SpoIIIE family protein (Protein is coded in complementary strand; from 3767931 to 3765604)