Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1328662
End position: 1328706
Length: 45

DNA sequence
>NC_008595, from 1328662 to 1328706 (45 bp); Mycobacterium avium 104 GGCGGCGGCGCGAACGGTGGCGGCCCGGACGGCGGCGGCGCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1328515-1329756	Sequence	MAV_1369 - hypothetical protein (Protein is coded in complementary strand; from 1329756 to 1328515)