Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1168016
End position: 1168060
Length: 45

DNA sequence
>NC_008595, from 1168016 to 1168060 (45 bp); Mycobacterium avium 104 TACGGCGCACCCGGGTACGGGCCGCCCGGGTAGGGGCCACCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1167242-1168261	Sequence	MAV_1219 - hypothetical protein (Protein is coded in complementary strand; from 1168261 to 1167242)