Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5230420
End position: 5230458
Length: 39

DNA sequence
>NC_008595, from 5230420 to 5230458 (39 bp); Mycobacterium avium 104 GCGGGCACGCTCCGCGGGCACGATCAGCGCGCACGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5229908-5231110	Sequence	MAV_5079 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 5231110 to 5229908)