Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 53172
End position: 53207
Length: 36

DNA sequence
>NC_008595, from 53172 to 53207 (36 bp); Mycobacterium avium 104 GCCGGGGCCGGGGCCTGGGCCGGGGCCGGGGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 52359-53459	Sequence	MAV_0054 - proline-rich 28 kDa antigen (Protein is coded in complementary strand; from 53459 to 52359)