Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5109764
End position: 5109799
Length: 36

DNA sequence
>NC_008595, from 5109764 to 5109799 (36 bp); Mycobacterium avium 104 CCCGTTCGACGGGCAGTTCGACGGGCCGTTCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5109751-5110857	Sequence	MAV_4965 - hypothetical protein (Protein is coded in complementary strand; from 5110857 to 5109751)