Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4956046
End position: 4956081
Length: 36

DNA sequence
>NC_008595, from 4956046 to 4956081 (36 bp); Mycobacterium avium 104 CACCGCCGCCGTGCCCGCCGCCGTCACCGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4955958-4957406	Sequence	MAV_4824 - hypothetical protein (Protein is coded in complementary strand; from 4957406 to 4955958)