Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4786380
End position: 4786415
Length: 36

DNA sequence
>NC_008595, from 4786380 to 4786415 (36 bp); Mycobacterium avium 104 GGTCGTCGTCGAGATCCTCGTCGAGGTCGTCGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4786022-4786990	Sequence	MAV_4655 - hypothetical protein (Protein is coded in complementary strand; from 4786990 to 4786022)