Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4739393
End position: 4739428
Length: 36

DNA sequence
>NC_008595, from 4739393 to 4739428 (36 bp); Mycobacterium avium 104 CGGGTTGTAGGGCGGGGTGTACGGCGGGTTGTAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4739091-4740761	Sequence	MAV_4606 - hypothetical protein (Protein is coded in complementary strand; from 4740761 to 4739091)