Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4463174
End position: 4463209
Length: 36

DNA sequence
>NC_008595, from 4463174 to 4463209 (36 bp); Mycobacterium avium 104 GGGGGCGCCTCGGGCGGCGTCTCGGGCGGCGTCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4462709-4465552	Sequence	MAV_4331 - hypothetical protein (Protein is coded in complementary strand; from 4465552 to 4462709)