Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4405687
End position: 4405722
Length: 36

DNA sequence
>NC_008595, from 4405687 to 4405722 (36 bp); Mycobacterium avium 104 CGATCGCGGCGGCCACCGCGGCGGCGACCGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4405626-4406222	Sequence	MAV_4276 - diguanylate cyclase/phosphodiesterase (Protein is coded in complementary strand; from 4406222 to 4405626)