Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3603506
End position: 3603541
Length: 36

DNA sequence
>NC_008595, from 3603506 to 3603541 (36 bp); Mycobacterium avium 104 GCGGCCCGCGCCTCGGCCCGGGCCGCCTCCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3602144-3603613	Sequence	MAV_3457 - hypothetical protein (Protein is coded in complementary strand; from 3603613 to 3602144)