Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3521476
End position: 3521511
Length: 36

DNA sequence
>NC_008595, from 3521476 to 3521511 (36 bp); Mycobacterium avium 104 TCGCGTCGCCGGTCGCTTCGCCGGCCGCGTCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3521448-3522239	Sequence	MAV_3376 - hypothetical protein (Protein is coded in complementary strand; from 3522239 to 3521448)