Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3489030
End position: 3489065
Length: 36

DNA sequence
>NC_008595, from 3489030 to 3489065 (36 bp); Mycobacterium avium 104 GCGGCTGGGTGACCGGCTGGGTGACCGGCTTGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3488786-3489073	Sequence	MAV_3344 - hypothetical protein (Protein is coded in complementary strand; from 3489073 to 3488786)