Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3248871
End position: 3248906
Length: 36

DNA sequence
>NC_008595, from 3248871 to 3248906 (36 bp); Mycobacterium avium 104 TTTTGGTGGCGGTTTTCGTCGCGGCTTTCGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3246170-3248911	Sequence	MAV_3155 - DNA polymerase I (Protein is coded in complementary strand; from 3248911 to 3246170)