Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 303370
End position: 303405
Length: 36

DNA sequence
>NC_008595, from 303370 to 303405 (36 bp); Mycobacterium avium 104 CGGGCACCGGGTCGGGCACCTCGTCGAGCACCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 302478-303446	Sequence	MAV_0308 - alcohol dehydrogenase, zinc-binding (Protein is coded in complementary strand; from 303446 to 302478)