Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2776213
End position: 2776248
Length: 36

DNA sequence
>NC_008595, from 2776213 to 2776248 (36 bp); Mycobacterium avium 104 GGTCGCCGACGTGGTCACCGACGCGGTCGCCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2775593-2776321	Sequence	MAV_2745 - hypothetical protein (Protein is coded in complementary strand; from 2776321 to 2775593)