Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2358035
End position: 2358070
Length: 36

DNA sequence
>NC_008595, from 2358035 to 2358070 (36 bp); Mycobacterium avium 104 GGTAGACCCAGTGATAGACCGAGTGGTAGGCCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2357532-2358551	Sequence	MAV_2355 - LppL protein (Protein is coded in complementary strand; from 2358551 to 2357532)