Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2260461
End position: 2260496
Length: 36

DNA sequence
>NC_008595, from 2260461 to 2260496 (36 bp); Mycobacterium avium 104 CGGCGGCGGAGGGGGCGGAGGCGGCGGCGGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2260387-2260599	Sequence	MAV_2252 - hypothetical protein (Protein is coded in complementary strand; from 2260599 to 2260387)