Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1639519
End position: 1639554
Length: 36

DNA sequence
>NC_008595, from 1639519 to 1639554 (36 bp); Mycobacterium avium 104 GGCGAGCACCAGCGCGATCACCAGGGCGACCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1639088-1639849	Sequence	MAV_1668 - hypothetical protein (Protein is coded in complementary strand; from 1639849 to 1639088)