Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 784378
End position: 784409
Length: 32

DNA sequence
>NC_008595, from 784378 to 784409 (32 bp); Mycobacterium avium 104 TTTTCCCCTGTTCCCCTGTTCCCCTGTTCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 783973-784884	Sequence	MAV_0823 - gp78 protein (Protein is coded in complementary strand; from 784884 to 783973)