Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4900617
End position: 4900646
Length: 30

DNA sequence
>NC_008595, from 4900617 to 4900646 (30 bp); Mycobacterium avium 104 CGCGTGCGCGGGCGCCTGCGGGTGCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4899595-4900845	Sequence	MAV_4775 purT phosphoribosylglycinamide formyltransferase 2 (Protein is coded in complementary strand; from 4900845 to 4899595)