Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4344228
End position: 4344257
Length: 30

DNA sequence
>NC_008595, from 4344228 to 4344257 (30 bp); Mycobacterium avium 104 GTGGCTTTAAGTGTCTTTAAGTGGCTTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4344255-4345772	Sequence	MAV_4216 - cationic amino acid transporter (Protein is coded in complementary strand; from 4345772 to 4344255)