Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4124615
End position: 4124644
Length: 30

DNA sequence
>NC_008595, from 4124615 to 4124644 (30 bp); Mycobacterium avium 104 CGGCGGTGGCGGGGGCGGTGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4124445-4124945	Sequence	MAV_4004 - hypothetical protein (Protein is coded in complementary strand; from 4124945 to 4124445)