Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3277744
End position: 3277773
Length: 30

DNA sequence
>NC_008595, from 3277744 to 3277773 (30 bp); Mycobacterium avium 104 CGGCGGCCGCGGCGGCGTCGGCGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3277251-3277871	Sequence	MAV_3184 hisH imidazole glycerol phosphate synthase subunit HisH (Protein is coded in complementary strand; from 3277871 to 3277251)