Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3090282
End position: 3090311
Length: 30

DNA sequence
>NC_008595, from 3090282 to 3090311 (30 bp); Mycobacterium avium 104 TCGCCGCCGGTGGCCGCCGAGCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3089880-3091673	Sequence	MAV_3054 - GNAT family acetyltransferase (Protein is coded in complementary strand; from 3091673 to 3089880)