Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2924264
End position: 2924293
Length: 30

DNA sequence
>NC_008595, from 2924264 to 2924293 (30 bp); Mycobacterium avium 104 TGTCGGCGTCGGTGTCGTAGTCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2922721-2925054	Sequence	MAV_2894 - preprotein translocase subunit SecA (Protein is coded in complementary strand; from 2925054 to 2922721)