Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 253001
End position: 253030
Length: 30

DNA sequence
>NC_008595, from 253001 to 253030 (30 bp); Mycobacterium avium 104 ACACGGACGCCCTCGGACGCGAACGGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 252926-253993	Sequence	MAV_0250 hisC aminotransferase (Protein is coded in complementary strand; from 253993 to 252926)