Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 18849
End position: 18878
Length: 30

DNA sequence
>NC_008595, from 18849 to 18878 (30 bp); Mycobacterium avium 104 GGCCGGGGGCGGGCGGTGGCCGCCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 18559-19824	Sequence	MAV_0019 - serine/threonine protein kinase (Protein is coded in complementary strand; from 19824 to 18559)