Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1677281
End position: 1677310
Length: 30

DNA sequence
>NC_008595, from 1677281 to 1677310 (30 bp); Mycobacterium avium 104 GTCGCCGACGCCGTCGCCGTCGCTGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1675806-1677422	Sequence	MAV_1700 - alpha-amylase (Protein is coded in complementary strand; from 1677422 to 1675806)