Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 680278
End position: 680304
Length: 27

DNA sequence
>NC_008595, from 680278 to 680304 (27 bp); Mycobacterium avium 104 TCGGCCATGCCGGCCATGGCGGCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 679894-681021	Sequence	MAV_0705 - alcohol dehydrogenase B (Protein is coded in complementary strand; from 681021 to 679894)