Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4873302
End position: 4873328
Length: 27

DNA sequence
>NC_008595, from 4873302 to 4873328 (27 bp); Mycobacterium avium 104 GCTGCCGCCGCAGCCGCCGCTGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4873136-4874140	Sequence	MAV_4750 - extracellular solute-binding protein, family protein 3