Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4437634
End position: 4437660
Length: 27

DNA sequence
>NC_008595, from 4437634 to 4437660 (27 bp); Mycobacterium avium 104 TTCGCGGTGTTCGCGGTGCTCGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4436408-4437760	Sequence	MAV_4306 - transporter, major facilitator superfamily protein