Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4376338
End position: 4376364
Length: 27

DNA sequence
>NC_008595, from 4376338 to 4376364 (27 bp); Mycobacterium avium 104 AGCACGCCGACCACGCCGAGCTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4375876-4377069	Sequence	MAV_4245 purK phosphoribosylaminoimidazole carboxylase ATPase subunit (Protein is coded in complementary strand; from 4377069 to 4375876)