Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4217186
End position: 4217212
Length: 27

DNA sequence
>NC_008595, from 4217186 to 4217212 (27 bp); Mycobacterium avium 104 CTCGTCGTGCTCCTCGTGCTCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4216998-4217558	Sequence	MAV_4095 - hemerythrin HHE cation binding domain-containing protein (Protein is coded in complementary strand; from 4217558 to 4216998)